This Page, created in March 2020, collects tips and news about the pandemic Covid-19 caused by the virus SARS-CoV-2.

In the coming years, this page will surely be outdated and no longer updated, but still we leave in remembrance of this important historical period.

---

View the performance of Covid19

There are internet pages that display the progress of the Covid-19 pandemic in all Nations of the world and in Regions and provinces of Italy.

The files that contain the raw data, updated every 24 hours from University John Hopkins and from the Civil Protection Italian, are published in Open Source on GitHub with the following addresses: Nations-Confirmed, Nations-Deaths, Nations-Recovered, Data-Italy, Data-Regions, Data-Provinces.

So we wrote an application to explore the data of these files in depth, both with graphics and in text format.

This application is a good example of displaying data in various formats (linear and logarithmic scales and various types of graphs and tables), so it can be used as an example and as a basis for creating similar applications even when the Covid19 pandemic is over.

Our application allows you to choose and view all the information,
while internet viewers show only part of it.

The comparative graphs show the differences between the various nations of the world and between the Italian regions.
You can use the mouse or its wheel on these graphs to see the evolution of data over time.

A note of 24/04/2020

These days in Italy (and also in other countries of the world) industrialists are lobbying to reopen everything, but by exploring the data it can be seen that in many regions the new infections and the number of deaths per day have not fallen. We are more or less at the maximum point of the curve and months have already passed.

Because of the greed of the industrialists, we made a fake LockDown, with the 66.7% of the moving national workforce (see the first few lines of the page 8 of this Inail document) and we caused a large number of deaths that could have occurreduti avoid, see This section.

If we continue to be foolish, the percentages will not only not drop to zero, but they will get up again and we will have it until Christmas. And say that if we closed everything, as the Chinese did, we could go down to almost zero in just one month.

Update of the “after Christmas”
The previous sentence, written almost a year ago, he said “until Christmas”. Then it seemed like an exaggeration, but here we are, in January of 2021, made even worse than last year. In the name of “god money” we took out a lot’ of grandparents and we also gave the virus time to develop a far more infectious variant of the initial virus. So now whoever wanted “make money” he has lost ten times more and will continue to lose, and it suits him well!

Simple instructions

• The four boxes at the top allow you to choose the country, the region, the province and the type of data to be displayed.
• To adjust the vertical scale, move the mouse cursor over the vertical area on the left, press the left mouse button and move the mouse up and down.
  – Pressing the mouse on the upper half of the vertical scale adjusts the maximum value.
  – Pressing the mouse on the lower half of the vertical scale adjusts the minimum value.
• To adjust the horizontal scale, press the left mouse button on the lower scale and move the mouse left and right.
• The two scales can be adjusted (vertical and horizontal) even with the mouse wheel, placing the cursor on the vertical scale, on the horizontal one or even on the graph.
• To move the displayed period left and right, press the left mouse button on the center of the graph and move the mouse left and right.
• The blue line “Average increase” represents the daily increase data, mediated in the last seven days. We did not use the raw increase data between one day and the previous, because they would be too jagged and therefore difficult to interpret.
• The green line “Deaths out of total”, represents the percentage of deaths, than the total number of cases.
• In the comparative charts (“Confirmed and Death”, “Confirmed and Incr”, “Deaths and Increments”, “Cases and deaths”, “Cases and Increments”, “Deaths and increases”), you can change the day with the mouse wheel, or by pressing the left mouse button on the graph and moving the mouse to the left.
• In the comparative graphs it is also possible to lock the scale during the change of days.
• In the comparative graphs you can highlight a region by clicking it with the mouse. Then, to return to the normal chart, click on the highlighted region.
• In the comparative graphs you can press the right mouse button and disable the nations (or regions) that don't matter. By disabling some nations “abnormal”, for example Qatar, the others can be viewed better.
• In the comparative graphs of the nations of the world a box appears to choose the number of nations to be displayed. By lowering the number of countries, those with few cases are excluded, who often have data errors, or data taken in a non-standard way. For example Qatar, which turns out to have a huge number of cases, expands the scale of the graph and compresses all other countries.
• In the application folder there is the new file “Population.txt”, which contains the number of inhabitants of the nations of the world and of the Italian regions. If you don't edit this file, or if the file does not exist, then the data from the 2019 written in the application itself.

Notes for versions

Version 1.0 – The application is fully functional, but in the next few days we will improve the central index, that moves a little’ changing the level of magnification. If we have the time we will also add other options for the data type, for example the percentage of deaths compared to the number of infected people.
Version 1.1 – We have corrected some small defects and added the percentage of deaths to the total number of cases. With the new parameter we discovered that in Lombardy the percentage of deaths has risen far higher than in the rest of Italy, he is now at 18% and is still going up, see This section.
Version 1.2 – We have added the new views “Confirmed and Death”, “Confirmed and Incr”, “Deaths and Increments”, “Cases and deaths”, “Cases and Increments”, “Deaths and increases”, which are useful for comparing the nations of the world and the Italian provinces in various respects.
Version 1.3 – Readability and colors have improved and we have solved some small problems. At last the central index remains stable on the same day, even when you zoom in or out on the chart.
Version 1.4 – Small corrections when using visualization “Original data”.
Version 1.5
– Improved the change of days with the mouse in the comparative graphs.
– Added ability to lock scale in comparison charts.
– Added tracks showing the trend of the last few days in the comparison charts.
Version 1.6
– Comparative charts now have logarithmic scales and better show the differences between regions.
– The comparative charts are more efficient and you can scroll the days fluidly with the mouse.
Version 1.7
– In the comparative graphs you can highlight a region by clicking it with the mouse.
– To return to the normal graph, click on the highlighted region.
Version 1.8
– Fixed the error that occurred with the Quatar data
– Added the ability to change the number of countries displayed in the comparison charts.
Version 1.9
– In the comparative graphs you can press the right mouse button and disable the countries that do not interest.
Version 2.0
– Added chart titles with names of countries and regions.
Version 2.1
– The comparative graphs of the Italian regions no longer worked because civil protection has changed the format of the data.
– Now the graphs automatically adjust to the new formats.
Version 2.2
– Corrected the horizontal position of the country number box
– Mouse wheel that works even on computers that have not set the flag “Scroll inactive windows”
– Fixed Num-Nations bug with LockScale
– Nations also in alphabetical order
– When you move the chart the position on the list is updated
– The percentage is now calculated on new cases
– Days of the week added
Version 2.3
– They blocked the ability to download files for which older versions no longer work
– In version 2.3 we had to use a different method to download the files.
– Sometimes the new method is slower than the previous one but if you have a fast network it can be even better than before.
Version 2.4
– We have restored the original operation (changing the Transport Layer Security from version 1.1 to 1.2)
Version 2.5
– Fixed an error that occurred if the data contained a field with “yyy”
– Now, when resizing the window, the graph also stretches horizontally following the size of the window.

Download of the application Theremino_Covid19 Version 2.5
Theremino_Covid19_V2.5
Theremino_Covid19_V2.5_WithSources (for programmers)
For all systems from Windows XP to Windows 10, both 32 which in 64 bit (Linux and OSX with Wine)

---

The virus SARS-2

The genetic code of this virus is small at less than 500 rows.

Start like this:
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
and it continues for about ten pages.

There are numerous variations of this code. Just change a single letter and the virus is not the same, but most of these mutations does not affect its operation.

Here is the complete code of the Wuhan-Hu-1, one of the first that have been sequenced in China:
CompleteGenome-Wuhan-Hu-1

This is instead the Cov2 sequenced in Italy 30 January 2020:
CompleteGenome-the-2_30gen2020_ITA

And from here you can download all the others and also build the phylogenetic tree that displays the sequence of mutations that connect them to each other:
www.ncbi.nlm.nih.gov….coronavirus

Codes and sequences

All of these ATTAAAGGTTTATACCTTCCCAGGTAA make us realize that a virus is nothing more than a short program. A much shorter code of the programs that we write on this site. But on the other hand is a code that makes use of billions of years of field testing and then reached an incredible efficiency and can do unimaginable things.

One of the great things that this tiny creature has already managed to do, He was to bow his head to all mankind. We are doing so understand that you can not go on, and if we learn the lesson we have to thank him.

For now, the language of these sequences there is largely incomprehensible, but we are on track and we can already make some useful operations.

phylogenetic Analysis

With the software open-source Nextrain you can find clues about the temporal development of virus.

Example phylogenetic map showing mutations in the SARS-CoV-2 and that has allowed us to establish that the first versions date back approximately to December 2019.

Comparison of versions

By comparison of the genetic sequences you can be searched of all kinds. For example, researchers from the School of Life Sciences at Peking University and the Institut Pasteur of Shanghai, under the supervision of the Chinese Academy of Sciences, They claim to have discovered the existence of two versions of SARS-CoV-2.

In their study, published on National Science Review, the newspaper of the same Chinese Academy of Sciences, illustrate the two distinct types of this virus: a defined Type-L, the other of Type-S.

According to their study the first, Type-L, It was much more contagious and deadly of the second.

DIY equipment

Treat the DNA is becoming easier, to the point that some equipment (for example for the chain reaction of DNA-Polymerase) They are also constructible with “DIY”, Here's an example: Simple-PCR

Create sequences

Even create new sequences and turn them into real bodies is becoming easier. With synthetic biology genes are created from scratch: “Type the ??DNA you want, print it out and transformed into yeast”. In recent years, for an average laboratory, to order custom DNA sequences from a synthesis company it has become a routine task: sequences are inserted into an online form and receive mail for a few days after DNA.

Of course you can do this only with harmless organisms such as yeasts. To treat the virus should be part of a certified laboratory with biosafety level 3 or 4.

---

hazardous Technologies

In the previous chapter we have shown that mess with the genetic sequences is becoming easy and affordable for everyone.

And it is even easier to develop biological weapons laboratories.

These laboratories as well as the most advanced techniques for sequencing and synthesis, make use of super-computers capable of creating billions of mutations per second.

And the computer can also simulate and select microorganisms with techniques similar to those of natural selection.

Therefore it is quite easy to produce sequences on the computer
and make them look naturally occurring mutations, for example in bats.

The banning of chemical and biological weapons, imposed by the Geneva Protocol as early as 1925, He did not stop the war policy of many countries (mainly the US), who openly continue to study them and to manufacture them.

---

Danger of censorship

And’ predictable that someone face objections on our right to propose ideas. For example, there is a “Cross pact for science” using unscientific methods (complaints to the judiciary) to obscure sites that publish ideas they do not like. This “pact” It was started by Burioni, televirologo unified networks that in 2009 it is not even able to pass a public competition (with just 9 total participants, himself included) all’University of Camerino, for the post of “University professor”. And in 2010 It was also rejected by’University of Catanzaro and from the Sapienza University of Rome.

Here are some links that inform on Burioni and its “pact”: LINK_1, LINK_2, LINK_3, LINK_4, LINK_5, LINK_6, LINK_7 (interesting link 7, which dissects the book Burioni and his statement “Science is not democratic”).

The real scientists do not use television, the complaints and complaints, do research in laboratories and then publish the results. They will then other scientists, and not the public of Barbara D'Urso, judging their ideas with “peer review”. Yet Burioni (You do not understand how) He has already partially succeeded in his aim inquisitorial, at least on social Smart-Phones. For example, if you open the link_4 with WeChat, the site of Radio Radio TV is blocked and appears This censorship message.

Since there is a danger that the former links are censored, here are the links to downloadable videos from an alternative source: LINK1, LINK2, LINK3, LINK4, LINK5

---

Therapy “DIY”

First of all it is important to clarify that we we do not sell anything,
we are only exposing ideas, may or may not like but they are only ideas.

It is also important to remember that
each has the right to defend their lives by any means,
even in the case that these means are not “officially recognized”.

Currently have confidence in medicine can be deadly, both the risk of becoming infected in hospitals, and because the majority of Covid-19 sufferers do not receive the necessary care. Most of them die in the hallway, or at home, or on a stretcher, or are a whole night in a chair, without even being able to go to the bathroom (out of order), no parrot (no one washes them), without intensive care, without oxygen… see the next chapter Video.

We're not accusing anyone, indeed we are sincerely grateful
for the sacrifices they are making doctors and nurses, Thank you!

But we are also keen to defend the right to fend by any means,
if relief not arriving, or you were deemed too old to deserve them.

---

Testimonials

Here are some testimonials about the end they made tens of thousands of people last month. People who have given their lives, with confidence, to those who could not save her:

SiroMarchesi, Genoa, Medici, SanRaffaele, GiovanniBosco, Aniñón, CartaBianca, Piedmont, Italiano_in_Cina

Italians who die, not for the virus, but due to lack of care or slowness, I am currently about six of every ten deaths, so well 500 everyday (31 March 2020). This data is easily controlled by calculating the mortality increase there has been in Italy, according to civil protection data and the World Health Organization. Here's how:

• The first of March 2020 – 1577 Total and infected 34 deaths – then 2% of deaths
• 10 March 2020 – 10149 Total and infected 631 deaths – then 3% of deaths
• 20 March 2020 – 47021 Total and infected 4032 deaths – then 9% of deaths
• 31 March 2020 – 105792 Total and infected 12428 deaths – then 12% of deaths
• 15 April 2020 – 165155 Total and infected 21645 deaths – then 13% of deaths
• 10 May 2020 – 219070 Total and infected 30560 deaths – then 14% of deaths

As can be seen clearly from the data, early March mortality was 2%, similar to that of China, German and American. Then mortality has grown to 14% (and is continuing to rise, note from 10 May 2020).

And in some regions it is even greater, for example here are the accounts for Lombardy:

• The first of March 2020 – 984 Total and infected 24 deaths – then 3% of deaths
• 10 March 2020 – 5791 Total and infected 468 deaths – then 8% of deaths
• 20 March 2020 – 22264 Total and infected 2549 deaths – then 11% of deaths
• 31 March 2020 – 43208 Total and infected 7199 deaths – then 17% of deaths
• 15 April 2020 – 62153 Total and infected 11377 deaths – then 18% of deaths

These data refer to Italy only and collected within a few weeks in the same way (see here). So you can not blame it on different valuation methods between countries. Nor you can think of other factors, such high percentage of elderly or genetic variations.

Mortality increases when there are no more places left, respiratory and oxygen to all. Also confirmed by official sources, as well as by doctors, nurses and patients, see the videos proposed above.

---

What if relief does not arrive

As shown in the previous chapter (if you have not already done watching video), a large number of people are dying every day because oxygen is not found, either because it comes too late or because you are left in a chair, or on a stretcher in the corridor until you become too serious to recover.

And even if the infected growth will start to slow down, however, the mortality rate will increase for months and eventually (within a few years) the Covid-19 would we have to take almost all. So it is good to get used to the idea that someone in the family, between uncles, grandparents, brothers and cousins, sooner or later will take.

And there will also be some family members who will struggle to breathe and will need oxygen to get through the worst days. So it is good to start thinking about it in time, Before it's too late (see for example the first video among those proposed in the previous chapter).

Please write messages at the end of this page.
Sharing experiences can be useful to others
and in some cases even save lives!

---

Oxygen concentrators

The Superior Health Council has given consent to the administration of oxygen by non-medical personnel and in This document he says verbatim: “Oxygen is not a drug whose administration is limited to a doctor or healthcare professional“.

From Wikipedia: The oxygen generators using PSA system are a source of cost-effective oxygen. They are safer, cheaper, and tend to be more convenient with respect to the cryogenic oxygen tanks or to the classic liquid oxygen tanks. … omissis … The portable oxygen concentrators are more effective in home care for patients with chronic respiratory insufficiency: the liquid oxygen tanks (stroller) They have limited autonomy that forces the patient to return to his home after a few hours. The portable oxygen concentrators instead allow the patient to not have temporal limitations as a self-production systems can be used with the battery or wherever there is an electrical power source (220V o 12V).

A question we are doing is: “How is it given the tragic shortage of cylinders that is causing hundreds of deaths each day, the NHS does not buy thousands of oxygen concentrators to give someone who has no place in intensive care, and dying in homes” ? (those who believe not look at the video of the previous chapter witnesses)

Oxygen concentrators are cheap (from 250 Euro up). No professional appliances, but they work and could save many lives, Here's what it is:
it.wikipedia.org/wiki/Concentratore_di_ossigeno

---

Models oxygen concentrators

There are many models of concentrators, here are a few examples from among the most readily available and among the best ratio between quality and price.

Please write messages at the end of this page.
Sharing experiences can be useful to others
and in some cases even save lives!

 

This model costs less than 200 Euro (from China), but it is really small (35 x 23 x 28 cm). It only delivers one liter per minute so in severe cases it may be insufficient.

Consume 125 Watt and it is quite noisy (50 DB).

 

 

This is one of the least expensive models, you can find it on eBay for 239 Euro, shipping included. The dimensions are of 21 x 21 x 30 cm and weighs 5.5 Kg

It produces 1 to 6 liters per minute (93% of concentration with one liter per minute), consume 120 Watt and noise is not specified.

The timer is adjustable up to 999 minutes (16 hours).

 

 

.
This model costs approx 230 Euro + 60 Shipping (on eBay). The dimensions are of 33 * 20 * 40 cm.

The output flow goes from 1 to 8 liters per minute, the stated noise is 43 dB and consumption is 110 Watts.

Of course, like all small appliances, comes to 93% only oxygen with low flow (1 liter per minute).

 

.
This model costs approx 290 Euro (on eBay with shipping included). The dimensions are of 27 x 23 x 30 cm and weighs 5.8 Kg.

The output flow goes from 1 liter per minute (93% of concentration) up to 7 liters per minute with lower concentration.

The noise is not specified and the consumption is of 120 Watts.

The timer is adjustable up to 999 minutes (16 hours).

 

.
This model costs approx 330 Euro (on eBay with shipping included). The dimensions are of 34 * 18 * 31 cm

The output flow goes from 1 to 6 liters per minute, the stated noise is 45 dB and consumption is 100 Watts.

Get to 90% of oxygen and only with low flow rates (1 liter per minute). The timer is adjustable with a maximum of 180 minutes.

 

 

This model costs approx 400 Euro (on Amazon with shipping included). The dimensions are of 28 * 18 * 34 cm and weighs 6.5 Kg.

The output flow goes from 1 liter per minute, with the 93% of concentration, up to 5 liters per minute. With 3 liters per minute provides the 60% of concentration.

The noise is of 54 dB and the consumption is of 100 Watts.

They specify NOT to use it for more than eight hours in a row.

 

 

This model costs approx 270 Euro (without atomizer) or about 290 Euro (with atomizer) on eBay with shipping included. The dimensions are of 36 x 23 x 32 cm.

The output flow goes from 1 liter per minute (93% of concentration) up to 5 liters per minute with lower concentration.

Noise is 45 dB and the consumption is of 120 Watts. There is a strange timer that they indicate with “cycle of 15 minutes within two hours” and that some sellers say they don't settle for less 5 minutes, not to damage the compressor.

 

The Chinese economic concentrators have excellent display and controls, often better than even the most expensive models.

The display of all models show the percentage of oxygen, the flow in liters per minute and the hours and minutes of the timer.

The controls are simple, five buttons around.

Click on the image for a larger view

 

 

This is the “Philips Respironics Everflo”, he would be found on Amazon for 600 Euro, but now “unavailable”. It is found from other retailers and even on eBay, but at very high prices, 1500-2000 Euro and beyond. The dimensions are 58 x 38 x 24 cm and weight 14 Kg.

And’ adjustable from 2 to 5 liters per minute, It has a noise of less than 40dB and consumes 295 Watts.

It can concentrate up to 88% oxygen even with the maximum range of 5 liters per minute.

 

 

This is the model “OXY-Relief “, it is found in various online retailers for about 800 Euro. The dimensions are 38 x 35 x 66 cm and weight 25 Kg.

And’ adjustable from 1 to 5 liters per minute, It has a noise of less than 40dB and consumes 350 Watts.

It can concentrate until all'93% oxygen but do not specify to what extent.

 

This is the “KRÖBER”, also one of the least noisy of the most expensive models, It costs about 1700 Euro. The dimensions are 53 x 20 x 52 cm without wheels, and weight 16 Kg

The characteristics are excellent, consumes only 280 Watt and has a noise of only 31 DB. The flow is adjustable from 1 to 5 liters per minute and has 30 thousand hours warranty.

It can give up to 85% of oxygen even with the maximum flow, weighs only 16 kg and even the USB interface.

 

There are also more expensive models, for example, the “Inogen ONE” for over 3000 Euro, with special features, for example the battery until 9 hours of battery life. Features that for Covid-19 interest us little.

---

Oxygen masks

There are various methods of administering oxygen, from less invasive (a double tube that is placed under the nose), until the complete masks or even the diving suits that wrap the whole head.

An intermediate solution, very efficient but still fairly comfortable to wear, are the mouth-nose masks you see in the following images. Surprisingly their price is very low, less than two complete pipe and accessories Euro. Here are some links where to find them: Link1 Link2

The first left is easier and more comfortable to wear, but it has the disadvantage of losing more than half of the oxygen produced from the apparatus concentrator.

The one on the right, call “High concentration mask”, sends the oxygen that is not used during exhalation to a soft bag, then making it available in greater quantities during inspiration. With this model, you can adjust the oxygen concentrator to a lower flow.

If, for example, with the simple mask he was to adjust the concentrator to the maximum (6 liters per minute), the second would be enough 2 to 3 liters per minute.

Adjust a lower flow allows the concentrator to work better, consume less, produce a higher concentration of oxygen and in many cases also be less noisy.

---

How much oxygen to administer

The Superior Health Council has given consent to the administration of oxygen by non-medical personnel and in This document he says verbatim: “Oxygen is not a drug whose administration is limited to a doctor or healthcare professional“.

However, it is good to know some basic rules to avoid a prolonged over-dosage which could cause hypercapnia (breathing so slow as to cause an increase in the level of carbon dioxide), or an under-dosage and therefore an insufficient oxygenation of the tissues.

The oxygen concentrators that we have indicated in the previous chapters do not generate high flows (6-8 liters per minute) with oxygen to 100%, so they are quite safe even if set at maximum for long periods.

But some people (especially heavy smokers) have chronic bronchitis (BPCO) and therefore a very low usual saturation (88-92%). These people, in the presence of a saturation higher than 92-95%, they begin to breathe too slowly and therefore do not eliminate carbon dioxide in sufficient quantities.

It would therefore be useful to have a pulse oximeter or pulse oximeter (you can find them on eBay for a fraction of what they cost in the pharmacy).

And it would be good to buy it BEFORE contracting Covid-19 in order to know its usual saturation. So in case of need you will know what the saturation should be.

Measuring with a pulse oximeter the usual saturations should be:

• COPD patient: ideal saturation target between 88% and 92%
• Patient without COPD: ideal saturation target between 94% and 98%.

When measuring with a pulse oximeter (Pulse Oximeter) it is good to tend to a saturation not higher than 98% because these devices do not measure the true concentration in the blood and therefore their measurement scale stops at 99%. For which, if you overdo it with oxygen, continue to score 99% and do not warn of the possible presence of dangerously high PO2 (130-150 and beyond) and not even a possible accumulation of carbon dioxide in the blood.

This graph shows that the saturation measured with a pulse oximeter (Pulse Oximeter) stops at 99-100% even in the presence of PO2 (arterial partial pressure of oxygen in the blood) higher than 100.

In conclusion, since we cannot measure true PO2 in the blood (too invasive), we will have to target the concentrations explained above (between 88% and 92% for patients with COPD, is between 94% and 98% for patients without COPD).

Emergency situations

In case of emergency, when the signs of hypoxia (insufficiency of oxygen) are obvious, you must not waste time with the oximeter and with the previous considerations. In these cases, oxygen must be regulated to the maximum, possibly using a mask with the reservoir to further increase its concentration.

In the event of an emergency, urgent help should be sought as soon as possible. And while waiting for help it is better to exaggerate with oxygen, because it would do more harm if you didn't give it, rather than giving more even if it wasn't necessary.

---

Arrangement of viruses colonies

In this image we see how the SARS-CoV-2 virus reproduces in large quantities on the cells of the lungs, up to create breathing problems.

Important to note that the virus colonies are located outside the lung cells,
in the area exposed to air.

The visible part of this image is one hundredth the size of a flea and the orange dots (i virus) they have a diameter of one ten thousandth of a millimeter. SARS-CoV-2 viruses are smaller than photons (light particles through which we see) and we cannot see them even magnifying them a thousand times with the best microscope. So this image was made with a electronic microscope, using electrons instead of normal light.

Viruses cover the lung cells and given their location it is difficult to reach them and inactivate them through the blood. Viruses are practically outside the body, in the area where there is no blood but air, and injectable medicines do not reach them.

---

Inactivation of viruses

In the next chart we see that with 4 parts per million of ozone will inactivate the virus in 20 minutes.
(data from: Ministry of Health – CNSA – October 2010)

And in the following table it is seen that it remains in region “non-toxic” also breathing a greater concentration (5 parts per million), for a longer time (30 minutes).
(data from: https://www.lenntech.it/ozono-esseri-umani.htm)

 

In the past months we have proposed ideas about a possible cure with oxygen and low ozone concentrations, but unfortunately the percentage of toxic ozone is very similar to the effective one. Also lately (May 2020) Some valid and proven effective treatments have been discovered, so it no longer makes sense to continue with these ideas.

However, the possibility of using ozone remains (and ultraviolet) to sterilize rooms and objects, as we will see in the next pages.

---

Ozone sterilizers

The biggest problem with ozone is that after filling a room with a high concentration of ozone, then it takes days to get it out from mattresses and blankets. And during that time there is a risk that the concentration is still too high to be able to sleep safely.

As we saw in the previous chapter, if you stay for a long time in a room with too high an ozone percentage you could have severe symptoms and even intoxication. So we are preparing a simple and cheap sensor that measures the percentage of ozone in PPM (parts per million) with great precision.

ATTENTION: Use the ozone generators found on the network
without measuring the ozone concentration it could be dangerous.

An example of the ozone generator:
https://www.ebay.it/itm/1-Pcs-10g-Portable-Car-Ozone-Generator-Ozonizer-Ceramic-Plate-Air-Sterilizer-12V-/254441329216

---

Ozone sterilizer for objects

An interesting and safe device could be a wardrobe to sterilize objects or clothing. In this case the ozone would remain sealed and therefore a very high concentration could be used, for example, 100 ppm, with which it would obtain a good sterilization in a few minutes.

In this case, ozone is better than ultraviolet because, being a gas, it can also reach the points that would be in the shade for ultraviolet.

This appliance would consist of:

• A closet with hermetic and timed closure.
• An ozone generator with a production of at least 10 grams per hour (you can find them on eBay for around 25 Euro).
• An MQ131 ozone sensor.
• A filter with aspirator to quickly extract ozone without putting it into the environment.
• A MiniPC that measures the concentration of Ozone and establishes the closing time.
• A Theremino Master module that reads the sensor and controls the generator, the aspirator and the door closing solenoid valve.

Example of time calculation:

• A large closet 50 cm, deep 60 cm and up 120 cm contains 360 liters of air.
• The air weighs about 1.3 grams per liter for which 360 liters do 468 grams.
• One hundred parts per million 468 grams do 0.0468 grams.
• A generator from 10 grams per hour ago 0.16 grams in a minute.
• So to get to a concentration of 100 ppm would suffice less than 20 seconds.
• And to get to 1000 ppm would suffice less than 180 seconds.

With a concentration of 1000 ppm turns off beyond 90% of viruses in about five seconds, so an overabundant uptime could be established, for example two minutes, which would give considerable safety without lengthening the cleaning cycle too much.

In conclusion, a five-minute cleaning cycle could be used, composed of 90 seconds of ozone generation, two minutes of activity and ninety seconds of ozone extraction.

UNDER CONSTRUCTION

… …

---

Inactivation of bacteria and viruses

 

Before proceeding with the reading we advise you to read these pages.

The study we propose, written by Pietro Semproni, provides in-depth knowledge of how viruses are transmitted and the inactivation effects caused by ultraviolet.

 

The degree of inactivation by ultraviolet radiation is directly related to the UV dose applied. The dosage, a product of UV light intensity and exposure time, It is usually measured in microjoules per square centimeter, or equivalently in microwatts per second to the square centimeter (µW · s / cm 2 ).

Dosages for killing the 90% bacteria and inactivation of 90% some viruses go by 2 to 8 mW per second per square centimeter. So if we count 5 mW per square centimeter and a power of 5 Watts, You can be sterilized around 1000 square centimeters in a second.

Calculating the walls of a room from 3 for 4 meters high and 2.5 meters are obtained 350 thousand square centimeters. Adding also the ceiling and floor you get to 590 Mila.

So with 5 Watt would cover the walls in 350 seconds, ie approx 6 minutes. And considering also ceiling and floor it would come to 590 seconds, so just under ten minutes.

The effectiveness of this sterilization method also depends on the configuration of the environment, if there are obstacles, efficacy depends on the point where the UV lamp is positioned. Another problem is the dust or dirt that can cover the lamp, reducing its effect. In addition, the lamps require annual replacement and cleaning at regular time intervals. An increase in effectiveness can be achieved by using a parabolic reflector. Aluminum has the highest reflection rate compared to other metals, and it is very useful for reflecting UV rays.

---

The most effective wavelength

In this image we can see that low pressure mercury lamps emit all their light power precisely in the area of ​​maximum germicidal efficiency and virus inactivation.

More information on the effect of the germicidal ultraviolet radiation:
https://it.wikipedia.org/wiki/Radiazione_ultravioletta_germicida
https://en.wikipedia.org/wiki/Ultraviolet_germicidal_irradiation
http://www.cisuvc.com/content/documents/files/GermicidalPower.AN.10.27.pdf

---

A sterilizer ultraviolet

We are designing a device to disinfect rooms (walls, handles, floors, money, objects, beds, thermometers etc ..) by means of ultraviolet, a kind of XENEX from 120 thousand dollars, but much lighter, Economic and easy to handle.

Here are two links that show the XENEX, a booth so heavy and uncomfortable that makes it impossible to sterilize some areas, for example under the beds and other surfaces that remain in shadow:
http://www.xenex.com/our-solution/lightstrike
https://www.youtube.com/watch?v=Eh3fY6c7_FQ

The appliance we are designing will be more powerful than XENEX, but handles like a vacuum cleaner, and allow (in a familiar and integral overalls person) totally disinfect a hospital room in less than ten minutes.

According to calculations, it takes about ten minutes to disinfect a large room 5 Watches at UVC. So the big version, for hospitals, it might have a power (consumed) by 36 or 44 Watt and a yield of approx 12 or 15 Watt in a UVC 260 NM.

Starting with double or triple power we have a good margin to compensate for the gradual depletion of the lamp and other inaccuracies in positioning or application times.

This version should also contain a computer and a distance sensor to help the operator cover all areas of the room at the right times.

This version could cost a few thousand euros.

---

economy version

You could also think and a reduced version with a few Watt UVC emission and without a computer. This cheaper version might be useful at home to sterilize money, wallets and other items.

But put in the hands of consumers a device could be a bad idea, given its danger. A device intended for consumers should be CE certified, but the CE mark for its nature certifies “harmlessness” of a product, and in this case we did not own. This appliance is very dangerous, and must be.

Of course those who would build for himself would not have these problems, We'll see…

---

Designing the UVC sterilizer

We have found that low pressure mercury lamps are significantly more efficient and less expensive than LEDs, for which we are modifying the project.

These are NOT the Xenon lamps used by the XENEX appliance that had deceived us for their poor efficiency. Open the image on the side that shows how Xenon lamps are about ten times less efficient than LEDs (at the wavelength that interests us to inactivate viruses).

• Efficiency of Xenon lamps : less than 0.5%
• LED efficiency from 260 NM : less than 2%
• Efficiency of low pressure mercury lamps : beyond the 30%

As seen in the image above, low pressure mercury lamps emit almost all their energy in a single line around the 254 NM.

In addition, unlike Xenon lamps, these lamps do not produce ozone. Thus an operator could disinfect many rooms in a row without danger of intoxication.

Finally these lamps have an efficiency of 30%, so with 18 Consumption watts produce 5.5 Watts of UVC all concentrated precisely on the wavelength which has the maximum virus inactivation effect. From here you can download the OSRAM DataSheet from 18 Watts

– – – – –

 

To obtain a sufficiently handy emitting head (wide approx 10 cm and long approx 25 cm) we will have to use two or three lamps from 18 Watts side by side, instead of a da 36 or 55 Watt that would be too long (over half a meter).

The most suitable lamps therefore appear “OSRAM HNS L 18 W 2G11” or their equivalents “PHILIPS TUV PL-L 18 Watts”.

 

---

UVC disinfector project

We are proceeding with the disinfector project. We may be able to do this with the following features:

• Fully wearable, without the caster base and the network cable.
• Interchangeable lithium battery from 2 Kg, for three hours of active operation (twenty large hospital rooms)
• Reasonable cost.
• With approx 100 Euros of material can be obtained 15 Watches at UVC (covering a room 4 x 3 x 2.5 meters less than 3 minutes).
• With others 100 About Euro is added the mini-pc and the distance sensor.
• Other 100 Euros are needed for each interchangeable power bank (from 12 Volts and 150 watt-hour).
• So with construction, testing and expenses should be in the thousand euros.

Components:

• MiniPC that calculates the right distance and time ratios and helps the operator not to forget about the areas (handle, walls, shaded areas under beds, etc…)
• Ultrasonic distance sensor to help the operator maintain the right combination of distance and time.
• ThereminoMaster module that reads the sensor the distance sensor, reads a button on the handle and turns the lamps on and off .
• From one to three low pressure mercury lamps (times are reduced up to three times).
• Ballast power supplies from 12 volts and 18 Watts, one for each lamp.

Component images (click on images to enlarge):

Lamp from 18 Watts without ozone production, “OSRAM HNS L 18 W 2G11” the equivalent “PHILIPS TUV PL-L 18 Watts”.

Width 10 cm and length approx 25 cm, so two or three could be placed side by side in a reasonably sized emitting head. The cost of three lamps plus three 2G11 sockets and three ballasts “ballast”, wanders about 100 Euro.

 

Feeder “ballast” from 18 Watts, with power supply a 12 volts (from 10 to 15 volts) and 1.6 Ampere. Efficiency of the 90% and cost of approx 5 Euro on eBay.

The ballasts could be in the initial part of the handle to balance the weight of the emitting head.

A Z85 MiniPC with Windows 10, placed in a backpack on the back, together with the battery pack and small control components.

The cost of the MiniPC, including even small electronic components (Master and distance sensor) wanders about 100 Euro.

 

Ready-made battery pack (with CE certification), or you could build it with lithium batteries and charge modules found on eBay.

There are numerous Power Station models similar to this. Models from 150 Watt-hours cost just over 100 Euro, so it is better to buy them already made.

With 150 Watt-hours feed three lamps from 18 Watts (multiple PCs and electronics) for over three hours. So twenty rooms can be made before changing the battery pack.

– – – – –

UNDER CONSTRUCTION

If someone will propose to produce this equipment
we will contribute for free
with the design of the control electronics and software development.

– – – – – –

We publish the project “Sterilizer ultraviolet” to take precedence and prevent anyone from patenting it.

We are always for the free movement of knowledge (see This page) and we have no intention to patent this idea. However, this publication makes “art note”, to put it in the jargon of the patent offices, and then we will always have priority and the ability to invalidate the validity of any patent.

If in the future someone will try to patent it, we can prove (by Site web.archive.org) that today, the 25 March 2020, This idea was already published and therefore in the public domain.

---

Masks

You should wear a mask every time you leave the house and this will become even more important in the coming months. Already today in many shopping centers can not even get in without a mask.

With the coronavirus on the loose is good to use appropriate masks. However at this time there are many false masks around.

So we present 3 simple tests to check the quality of surgical masks.

A good quality surgical mask generally has three layers, with the innermost layer which absorbs moisture, the intermediate layer which acts as a filter and the outermost layer that repels water.

To run the tests you need to sacrifice a mask. So we recommend to make tests at the end of the day before you throw away the mask.

1) visual Test

If a mask 3 layers, logically, should have 3 layers. Cutting it, you should see 3 very obvious layers.

The 3 layers normally consist of a translucent piece (up), White (to the center) it's colored (Green, blu, or white) .

2) water Tests

Surgical masks, not only protect others by coughing and sneezing, but also provide protection from other. Therefore, the outer layer is designed to be waterproof.

Fold the mask in such a way that the outer side forms a funnel and pour water into. You should be able to see that the mask retains water properly. After a time touches the bottom of the funnel and make sure it is not damp or wet.

3) Fire Test

The intermediate layer must be a filter, not a piece of paper. Therefore, with the flame of a lighter should charring, but must not catching fire as would a normal piece of paper.

---

Production of masks

Our collaborator in China visited a company that makes surgical masks and thought to propose on the site www.store-ino.com, also were cheap, but unfortunately the expedition to Italy was too expensive.

So there was a real risk of making the figure profiteers, so they decided to let it go and the only thing we can offer and video showing how they are built.

– – – – – –

Please write messages at the end of this page.
Sharing experiences can be useful to others
and in some cases even save lives!